Preview

Theory and practice of meat processing

Advanced search
Vol 1, No 3 (2016)
View or download the full issue PDF (Russian) | PDF
https://doi.org/10.21323/2414-438X-2016-1-3

4-13 1653
Abstract
The risks associated with the presence of antimicrobial drug residues in meat and products of animal slaughter were determined. One of them is the emergence of antimicrobial resistance in pathogenic and conditionally pathogenic microorganisms isolated from meat and products of animal slaughter. It was established that Escherichia coli, Salmonella and Pseudomonas were resistant to ampicillin, tetracycline, tylosin and cephalolexin. However, Listeria monocytogenes did not have resistance to these antibiotics. It was also established that when entering an animal body, antimicrobials were accumulated mostly in liver and kidneys of an animal followed by meat and, to the least degree, in fat. It was found that up to 65% of the tested samples were contaminated with antimicrobials to a greater or lesser degree.
14-20 1610
Abstract
Highly sensitive and specific method for identification of pathogenic prion protein was developed. It was found that the water-soluble fractions of beef proteins and plasma proteins of farm animals are normal prion proteins in cattle. Aligning gene sequences of pathogenic and normal prion protein of sheep (Ovis aries) revealed that the nucleotide sequences of PrPc and PrPsc are identical. Murine monoclonal antibody 15B3 was selected. Synthetic sequence of 194 bps was randomly produced (DNA-tail). The produced sequence and the database sequences have no homologues. Two primer of
20 bps were selected for synthesized DNA-tail. The experimental data indicate that by using AGTCAGTCCTTGGCCTCCTT (left) and CAGTTTCGATCCTCCTCCAG (right) primers the amplification should be performed as follows: pre-denaturation, 95 °C, 60 seconds, 1 cycle; denaturation, 95 °C, 30 seconds, 30 cycles; annealing, 56 °C, 60 seconds, 30 cycles; elongation, 72 °C, 30 seconds, 30 cycles, additional elongation, 1 cycle, 600 seconds. The optimum concentration of reaction mixture components for PCR was established. High specificity of the developed test system and oligonucleotide primers was confirmed by electrophoretic separation of ground beef samples containing  pathogenic prion protein, as well as by comparative analysis of the results of pathogenic prion protein determination. These results were obtained using PCR test system and TeSeE™ ELISA system.
21-34 1825
Abstract
The scientifically substantiated and established temperature and humidity conditions of storage of sterilized canned meat are a temperature in a range from 0 to + 20 °С and the air relative humidity not more than 75%. However, in the harsh and extreme climate
conditions of the Russian regions, it is extremely difficult or practically impossible to ensure the normative temperature and humidity conditions when transporting canned foods to a consumer, as well as at short-term storage. Therefore, obtaining new experimental data on an effect of the non-normative temperature and humidity
conditions of the sterilized canned foods on the indicators of product safety and quality are topical and important for understanding the character and depth of the destructive processes occurring in a product.
It was noted that an abrupt change in the climatic conditions did not have a stimulating effect on microflora development in the tested samples. All samples were commercially sterile. The histological investigations proved an increase in the degree of muscle tissue destruction in the unregulated storage conditions: microfractures and narrow cross fractions had a multiple character, an amount of fine-grained proteinous mass  increased. It was established that freezing and subsequent storage had a stronger negative effect on the degree of protein destruction and aroma of the broth and meat of the canned foods compared to the unregulated temperature and humidity storage conditions. For example, the mass fraction of protein nitrogen and essential amino acids decreased on average by 7.8%. The preservation of the fatty constituent of the canned foods in the stably freezing condition was considerably higher than in case of alternating freezing and defrosting. The degree of a decrease in the sum content of monounsaturated fatty acids in the canned foods in the unregulated conditions
was on average more than 20%, those of polyunsaturated fatty acids was more than 31%. It was shown than freezing of canned food at stably low temperatures led to the most pronounced negative impact on the aroma of broth and meat. On average, the degree of the effect of the stably low temperatures was higher by 5.4% compared to the canned food stored in the unregulated temperature and humidity conditions.
The content of vitamins and accumulation of products of protein hydrolysis by the phases «pepsin-trypsin» in canned meat did not change in the studied time period.
35-47 2130
Abstract
The problem of healthy and quality nutrition has a global character. The modern development of technologies including nanotechnologies allowed obtaining materials with unique properties, which began to be actively used in food industry and agriculture
but, at the same time, require thorough investigation of their properties and effects on the human body and environment. The paper demonstrates the main directions of the nanotechnology use in the agricultural production and food industry, examines the safety
problems and risks occurred when using nanotechnologies in food industry with account for insufficient research on the influence of food nanotechnologies on human health and environmental ecology, and presents the normative and methodical base of the Russian
Federation for assurance of safe consumption of food products produced from nanomaterials.
48-56 2191
Abstract
In the present review, we focus on the features of the collagen structure. In particular, we report the correlation between the amount of proline and hydroxyproline and the temperature of denaturation, as well as the changes of collagen structure after thermal treatment. After cooling, denaturated collagen forms dense jellies which may absorb a large amount of water. The influence of pH on the denaturalion temperature, solubility and
the strength characteristics of collagen-containing proteins are described. The review also describes the data on the influence of various food additives and chemicals (acids, alkalis, salts i.a. phosphates, hydrocolloids) on the collagen protein structure and technological properties. The effect of acids, alkalis, salts on the properties of collagen depends
on the nature and strength of the ions and their affinity for the collagen ions. The interactions between the collagen proteins and hydrocolloids result in the synergetic effect. Phosphates and collagen form solid structures.
57-65 1854
Abstract
In the world practice, the radiation technologies for food product processing are extensively used; with that, free radicals are found in products. Scientists have not made a final conclusion about the complete safety of the method of radiation sterilization, so it is very important to control irradiated food products to determine
a fact of irradiation and residual effects. The experimental data obtained on the domestic spectrometer EPR series Labrador Expert X, which was developed by Spektr LLC with the assistance of the research team of the authors from the Institute of Natural Sciences of UrFU named after Yeltsin B. N., indicate the presence of free radicals in the samples of boneless beef, which is probably associated with °Ccurrence of ante-mortem technological and slaughter stress in animals. Irradiation of the chicken meat samples carried out in laboratory conditions allows a comparison of the spectra before and after irradiation. The dose of irradiation of poultry was 12 kGy. This dose was selected based on the practice of recognizing the radiation doses of 10-12 kGy as safe, which was established in many countries. It was found that in the range of the magnetic fields from 3272 to 3280 Gs, there was a weak EPR signal with an amplitude of 7.28 e-05 and D less than 1. Such a background signal can be explained by stress in the birds, peculiarities of feeding and other factors. After irradiation at a dose of 12 kGy, the ESR signal increased in the range of the magnetic fields from 3273 to 3286 Gs and D was higher than 1. This technology or, in other words, radappertization, is an industrial
sterilization of food products for long storage at positive temperatures, which precludes re-contamination by microorganisms. After irradiation, the fivefold increase in the amplitude of the ESR signal was observed and two additional signals with small amplitude appeared. The fact of irradiation/absence of irradiation of the samples was also confirmed by calculation according to GOST R 52529-2006. The need for further research of meat and meat products by the EPR method is obvious: to determine a fact of sterilization or radurization, to determine a radiation dose, to accumulate reliably
established information on radiation sensitivity and to develop a methodological base for the use of an EPR spectrometer.
66-80 3973
Abstract
The article presents an analysis and formalization of existing methods for calculating the performance of different equipment for mechanical processing of raw materials with screw working body (grinders, mixers, pumps). It is noted that these methods do not consider the presence of counterpressure at the exit, where the reverse flow of the processed raw material is observed. Thus, the calculation of performance (e.g. grinders and pumps) is carried out more simply through the use of single empirical coefficient linking the design parameters, structural and mechanical properties of raw materials and the value of counterpressure with performance. It is shown that the existing calculation methods are developed for a homogeneous medium using Newtonian isothermal models and that their adjustment to experimental data was carried out by
introducing the relevant empirical coefficients. These recommendations are widely used, but they do not allow the calculation of performance based on the counterpressure.
The study was conducted mathematically by the method based on the technique of «deployment of the screw channel» in the form of a rectangle covered by plate (wall of the working cylinder) and moving at a constant speed. The main attention is drawn to the assumption that the screw channel has the form of a rectangle, one side of which is equal to the depth of thread and the second side is equal to the pitch of thread.
The equation linking volumetric performance with the geometric parameters of the screw, the formula for determining the volumetric
performance of the reverse flow and the equation linking the
actual performance of the screw with its geometrical parameters,
rotation speed, counterpressure and the rheological characteristics
of raw materials are developed. The value of performance loss
for the screw press is calculated considering reverse flow of meat
through the gap. For the first time, a method for calculating the
performance of mechanical deboning screw presses is developed allowing
to consider the effect of the gaps between the tip of the screw
and the chamber, as well as the effect of «sleeve-screw» gaps on the
value of the performance loss.
81-95 2321
Abstract
Price setting is as complex process, which requires taking into consideration
many factors. In different periods, the systems of price setting existed in the meat sector of the agro-industrial complex, which took into account only the external factors: competition, value of goods and production costs. The system of price formation that
was in existence in Russia up to now was based only on the costbased principle. Transition to formation of the free market prices practically has not led to changes in the methodological approaches in price setting and has not influenced their structure. The current price formation system in the meat sector of the agro-industrial
complex does not correspond to the contemporary requirements of the economic science. Thus, it is an obstacle on the way of introduction of the objective economic laws in conditions of the market relations. It is possible to achieve production efficiency with such use of the existing resources when the differentiated production costs are proportional to the utility of these resources. The utility of products is determined by a complex of properties that reflect their value in use. The main qualitative parameters are consumer properties of products. The main internal factor influencing the price
parameters is the qualitative composition of raw material. In order to create parity in price setting for different groups of products, the unified method of price equivalence with regard to the qualitative parameters of the raw material constituent was developed. Quality characteristics of meat products are composed of the product structure, morphology and chemical composition, and, finally, coefficients of consumer properties calculated with consideration for all above-mentioned factors.


Creative Commons License
This work is licensed under a Creative Commons Attribution 4.0 License.


ISSN 2414-438X (Print)
ISSN 2414-441X (Online)