RESEARCH AND DEVELOPMENT CONTROL METHOD PATHOGENIC PRION INFECTIONS SECONDARY RAW MEAT INDUSTRY


https://doi.org/10.21323/2414-438X-2016-1-3-14-20

Full Text:


Abstract

Highly sensitive and specific method for identification of pathogenic prion protein was developed. It was found that the water-soluble fractions of beef proteins and plasma proteins of farm animals are normal prion proteins in cattle. Aligning gene sequences of pathogenic and normal prion protein of sheep (Ovis aries) revealed that the nucleotide sequences of PrPc and PrPsc are identical. Murine monoclonal antibody 15B3 was selected. Synthetic sequence of 194 bps was randomly produced (DNA-tail). The produced sequence and the database sequences have no homologues. Two primer of
20 bps were selected for synthesized DNA-tail. The experimental data indicate that by using AGTCAGTCCTTGGCCTCCTT (left) and CAGTTTCGATCCTCCTCCAG (right) primers the amplification should be performed as follows: pre-denaturation, 95 °C, 60 seconds, 1 cycle; denaturation, 95 °C, 30 seconds, 30 cycles; annealing, 56 °C, 60 seconds, 30 cycles; elongation, 72 °C, 30 seconds, 30 cycles, additional elongation, 1 cycle, 600 seconds. The optimum concentration of reaction mixture components for PCR was established. High specificity of the developed test system and oligonucleotide primers was confirmed by electrophoretic separation of ground beef samples containing  pathogenic prion protein, as well as by comparative analysis of the results of pathogenic prion protein determination. These results were obtained using PCR test system and TeSeE™ ELISA system.

About the Authors

A. Y. Prosekov
Kemerovo Technological Institute of Food Industry (University), Kemerovo, Russia
Russian Federation
Dr. Sci. (Eng.), Professor


O. V. Kriger
Kemerovo Technological Institute of Food Industry (University), Kemerovo, Russia
Russian Federation
Ph.D., Associate Professor


References

1. Kriger, O.V. Prion infection: characterization of pathogens and methods for the diagnosis of transmissible spongiform encephalopathies in cattle / O.V. Krieger, O.V. Kozlovа, A.Y .Prosekov //Herald NGAU. — 2011. — № 3. — P. 85–89.

2. Mudrikova, O.V.Issledovanie content of the normal prion protein in cattle in samples of biological origin / O.V Mudrikova, O.V. Kriger, A.Y Prosekov, A.R Hananova, S.Y Garmashov // Advances in science and agribusiness technology. — 2011. — № 11. — P. 77–79.

3. Kriger, O.V The main aspects of designing primers for certain types of DNA supplies of cattle using polymerase chain reaction / O.V Krieger, L.S Soldatov, A.Y Kravchenko M.V Novoselovа //Modern problems of science and education. — 2012. — № 2. — P. 362.

4. Dragunovа, E.E PCR test system for the identification of pathogenic prion protein: the need to develop, manufacture technique and the basic characteristics / E.E Dragunovа, I.S. .Milentyeva, O.V. Kriger, M. Novoselovа // Basic Research. — 2013. — № 10. — Part 8. — C. 1739–1740.

5. Moskvina, N.A. Application of polymerase chain reaction for species identification products processing plant raw materials /N.А. Moskvina, Y. Golubtsovа, O.V. Kriger // Engineering and technology of food production. — 2014. — № 2. — P. 126–129.

6. Dragunovа, E.E. Phylogenetic analysis of the degree of kinship evalyutsionnogo sequences of prion protein / E.E. Dragunovа, I.S. Milentyeva, O.V. Kriger, M. Novoselovа // Food and Biotechnology Innovation: Proceedings of the international scientific forum. — Kemerovo, 2013. — P. 172–180.

7. N.A. Moskvina DNA markers based on polymerase chain reaction — as a method of assessing the hygienic variety of fruit raw material / N.A. Moskvina, Y. Golubtsova, L.S .Dyshlyuk, A.Y. Prosekov // Theoretical and applied aspects of modern science. — 2015. — № 7–1. — P. 134–137.

8. Prosekov A.Y. Prototyping gineticheskih molecular test kits for the detection and typing of prion infections / A.Y. Prosekov, O.O. Babich, M. Novoselovа // In: International Scientific-Practical Conference Biotechnology and quality of life: the materials of the international scientific-practical conference. Moscow 2014. — P. 577–578.

9. Prosekov A.Y. Influence of processing food raw materials on the effectiveness of specific identification / A.Y. Prosekov, Y. Golubtsova, K.A. Shevyakova // Food Industry. — 2014. — № 6. — P. 8–10.

10. A.Y. Prosekov The study of composition and properties of proteins of animal origin of biological objects and dairy products multicomponent composition / Prosekov A.Y, Pozdnyakovа A.V . // Bulletin of the Krasnoyarsk State Agrarian University. — 2014. — № 8. — P. 101–107.

11.


Supplementary files

For citation: Prosekov A.Y., Kriger O.V. RESEARCH AND DEVELOPMENT CONTROL METHOD PATHOGENIC PRION INFECTIONS SECONDARY RAW MEAT INDUSTRY. Theory and practice of meat processing. 2016;1(3):14-20. https://doi.org/10.21323/2414-438X-2016-1-3-14-20

Views: 464

Refbacks

  • There are currently no refbacks.


Creative Commons License
This work is licensed under a Creative Commons Attribution 4.0 License.


ISSN 2414-438X (Print)
ISSN 2414-441X (Online)