Search


Order results by:     
 
Issue Title
 
Vol 3, No 3 (2018) PERSPECTIVE WAYS THE USE OF BY-PRODUCTS Abstract  PDF (Eng)  similar documents
Viktoriya V. Nasonova
"... and a number of macro- and micronutrients. The main directions of using the different types of by-products ..."
 
Vol 1, No 3 (2016) RISKS AND SAFETY OF USING NANOTECHNOLOGIES OF FOOD PRODUCTS: A REVIEW Abstract  PDF (Eng)  similar documents
N. A. Gorbunova, E. K. Tunieva
"... and methodical base of the Russian Federation for assurance of safe consumption of food products produced from ..."
 
Vol 1, No 3 (2016) PRINCIPLES OF DETERMINATION OF VALUE IN USE FOR MEAT AND MEAT PRODUCTS BASED ON QUALITY INDICATORS — THE COEFFICIENTS OF CONSUMER PROPERTIES Abstract  PDF (Eng)  similar documents
N. F. Neburchilova, I. V. Petrunina
"... requirements of the economic science. Thus, it is an obstacle on the way of introduction of the objective ..."
 
Vol 1, No 2 (2016) CHARACTERISTICS OF STRUCTURE FORMATION IN COOKED SAUSAGE PRODUCTS USING SONOCHEMICAL TECHNOLOGIES Abstract  PDF (Eng)  similar documents
A. M. Yevtushenko, O. N. Krasulya, I. G. Krasheninnikova
"... This paper studies the features of formation of sausage product structure in the process ..."
 
Vol 3, No 1 (2018) MODERN TRENDS IN THE DEVELOPMENT OF THE FUNCTIONAL FOOD INDUSTRY IN RUSSIA AND ABROAD Abstract  PDF (Eng)  similar documents
Andrey B. Lisitsyn, Irina M. Chernukha, Olga I. Lunina
"... the nutritional value of modern products and making  them healthier. Functional foods are one of the ways to solve ..."
 
Vol 1, No 3 (2016) ASSESSMENT OF RADIATION SAFETY OF CHILLED MEAT USING THE METHOD OF ELECTRON PARAMAGNETIC RESONANCE Abstract  PDF (Eng)  similar documents
R. T. Timakova, S. L. Tikhonov, A. N. Tararkov, I. S. Kudryashov
"... In the world practice, the radiation technologies for food product processing are extensively used ..."
 
Vol 3, No 3 (2018) MULTI–CRITERIA OPTIMIZATION OF A PRODUCT RECIPE COMPOSITION Abstract  PDF (Eng)  similar documents
Marina A. Nikitina, Irina M. Chernukha
"... non-dominative options of food products, but slightly extend a subset by choosing a nucleus ..."
 
Vol 1, No 1 (2016) NUTRITIONAL VALUE OF NEW UNCOOKED SMOKED PORK PRODUCT Abstract  PDF (Eng)  similar documents
Yu. Yu. Zabalueva, B. A. Bazhenova, K. S. Nazimova
"... of the standard for this type of products by the content of protein (13.2%) and fat (27.8%). The uncooked smoked ..."
 
Vol 3, No 1 (2018) POSSIBILITIES OF USING STABLE ISOTOPES FOR IDENTIFICATION OF GEOGRAPHICAL ORIGIN OF MEAT AND MEAT PRODUCTS. A REVIEW Abstract  PDF (Eng)  similar documents
N. A. Gorbunova
"... of geographical origin of raw materials and animal-derived products to exclude a possibility ..."
 
Vol 1, No 4 (2016) NEW MEAT PRODUCTS WITH IMMUNOMODULATORY EFFECT CREATION METHOD Abstract  PDF (Eng)  similar documents
I. V. Kaltovich, O. V. Dymar
"... characteristics of technological stages of manufacture of those types of meat products, including issues ..."
 
Vol 2, No 4 (2017) AN INFLUENCE OF SPONTANEOUS MICROFLORA OF FERMENTED HORSEMEAT PRODUCTS ON THE FORMATION OF BIOLOGICALLY ACTIVE PEPTIDES Abstract  PDF (Eng)  similar documents
I. M. Chernukha, I. N. Nikonov, N. G. Mashentseva, D. L. Klabukova, D. A. Afanasev, L. I. Kovalyov, L. А. Ilina
"... their detail study. This paper examines an effect of spontaneous microflora of fermented meat products from ..."
 
Vol 3, No 3 (2018) IN VIVO ENRICHMENT OF THE LAMB OF ESSENTIAL TRACE ELEMENTS FOR ITS USE IN THE TECHNOLOGY OF FUNCTIONAL FOODS Abstract  PDF (Eng)  similar documents
Tatiana M. Giro, Ivan F. Gorlov, Marina I. Slozhenkina, Sergey V. Kozlov, Nogman V. Tasmuchanov
"... products with balanced essential nutrients. Based on the data on greater localization of microelements ..."
 
Vol 2, No 4 (2017) FORMATION OF THE SCIENTIFIC BASIS OF META-DATA ASSOCIATED WITH ESTIMATES OF «ONCO-» RISKS LINKED TO MEAT PRODUCTS Abstract  PDF (Eng)  similar documents
N. L. Vostrikova, O. A. Kuznetsova, A. V. Kulikovskii, M. Yu. Minaev
"... products. In October 2015, World Health Organization (WHO) published a report, in which red meat ..."
 
Vol 3, No 3 (2018) METHODOLOGICAL ASPECTS OF IDENTIFICATION OF TISSUE-SPECIFIC PROTEINS AND PEPTIDES FORMING THE CORRECTIVE PROPERTIES OF INNOVATIVE MEAT PRODUCTS Abstract  PDF (Eng)  similar documents
Natal’ya L. Vostrikova, Irina M. Chernukha, Daniil V. Khvostov
"... One of the ways to address the food quality issues facing the industry is the development ..."
 
Vol 1, No 3 (2016) RISKS ASSOCIATED WITH THE PRESENCE OF ANTIMICROBIAL DRUG RESIDUES IN MEAT PRODUCTS AND PRODUCTS OF ANIMAL SLAUGHTER Abstract  PDF (Eng)  similar documents
D. S. Bataeva, E. V. Zaiko
"... The risks associated with the presence of antimicrobial drug residues in meat and products ..."
 
Vol 2, No 1 (2017) SELECTION OF DNA MATRIX FOR JUSTIFICATION OF THRESHOLD FOR CONTAMINATION OF PROCESSED MEAT PRODUCTS WITH UNDECLARED POULTRY COMPONENTS Abstract  PDF (Eng)  similar documents
M. Yu. Minaev, G. I. Solodovnikova, K. A. Kurbakov
"... industry enterprises that carry out the combined processing of slaughtering products from farm animals ..."
 
Vol 2, No 3 (2017) THE USE OF TOOLS DENSITOMETRY IN THE QUANTITATIVE COMPUTATIONS OF PROTEIN FRACTIONS Abstract  PDF (Eng)  similar documents
Natalia L. Vostrikova
"... markers related to quality, functionality and safety of food raw materials and finished products ..."
 
Vol 1, No 3 (2016) CALCULATION OF PERFORMANCE FOR MECHANICAL DEBONING SCREW PRESSES CONSIDERING COUNTERPRESSURE Abstract  PDF (Eng)  similar documents
A. S. Ostroukh, V. A. Abaldova
"... производят упрощенно за счет использования одного эмпирического коэффициента, связывающего конструктивные ..."
 
Vol 1, No 2 (2016) USE OF MEAT-BONE PASTE AS A PROTEIN SOURCE IN MEAT PRODUCT PRODUCTION Abstract  PDF (Eng)  similar documents
A. K. Kakimov, B. B. Kabulov, Zh. S. Yessimbekov, N. A. Kuderinova
"... instead of the basic raw material in meat product production. The comparative analysis of the nutritive ..."
 
Vol 2, No 2 (2017) FOOD HYPERSENSITIVITY AND PRODUCTS OF ANIMAL ORIGIN RESOURCES Abstract  PDF (Eng)  similar documents
A. B. Lisitsyn, I. M. Chernukha, O. I. Lunina
"... every year. Food intolerance is classified into following types: enzymopathy; leaky gut syndrome ..."
 
Vol 1, No 2 (2016) INVESTIGATION OF SANITARY-HYGIENIC CHARACTERISTICS OF MULTILAYER POLYMER FILMS USED FOR VACUUM PACKAGING MODIFIED BY NATIVE ANTIMICROBIAL COMPONENTS Abstract  PDF (Eng)  similar documents
O. B. Fedotova, D. M. Myalenko
"... of multilayer polymer film materials where the inner layer contacting directly with food product is modified ..."
 
Vol 1, No 3 (2016) RESEARCH AND DEVELOPMENT CONTROL METHOD PATHOGENIC PRION INFECTIONS SECONDARY RAW MEAT INDUSTRY Abstract  PDF (Eng)  similar documents
A. Y. Prosekov, O. V. Kriger
"... .н. Полученные экспериментальные данные указывают на то, что при использовании праймеров AGTCAGTCCTTGGCCTCCTT ..."
 
Vol 4, No 1 (2019) LOW-TEMPERATURE ATMOSPHERIC-PRESSURE PLASMA IN MICROBIAL DECONTAMINATION AND MEAT TECHNOLOGY. A REVIEW Abstract  PDF (Eng)  similar documents
Natalia A. Gorbunova
"... . Depending on the plasma type, the significance of each of the listed mechanisms for increasing ..."
 
Vol 2, No 1 (2017) STUDY ON THE BIOLOGICAL VALUE OF PROTEINS WITH HYPOTENSIVE PROPERTIES FROM AIR-DRIED BEEF Abstract  PDF (Eng)  similar documents
O. A. Kovaleva, C. M. Zdrabova
"... -dried beef products on a degree of protein hydration and solubility. The processes of the protein ..."
 
Vol 2, No 4 (2017) THE SCIENTIFIC APPROACH OF DETERMINATION POULTRY GRADE AND POULTRY PRODUCTS Abstract  PDF (Eng)  similar documents
V. N. Makhonina, V. P. Agafonychev
"... .77 to 81.14%. The new approach of the definition types of meat poultry and poultry products increases ..."
 
Vol 2, No 4 (2017) STUDY ON DECREASE OF NITRITE AND NITRATE USAGE IN PROCESSED MEAT WITH ADDITION OF NATURAL SALT AND CARBON MONOXIDE Abstract  PDF (Eng)  similar documents
R. Sakata, S. Takeda, M. Waga
"... This study was carried out to examine the reddening of meat products due to the addition ..."
 
Vol 3, No 1 (2018) SOUS VIDE TECHNOLOGY — SEVERAL ASPECTS OF QUALITY AND MICROBIOLOGICAL SAFETY Abstract  PDF (Eng)  similar documents
Tatyana S. Fofanova
"... of the  increasing number of people to consume «healthy» products and not to spend much time on their preparation led ..."
 
Vol 2, No 2 (2017) INULIN AS A PREBIOTIC AND FAT REPLACER IN MEAT PRODUCTS Abstract  PDF (Eng)  similar documents
Dragan Vasilev, Vesna Djordjević, Nedjeljko Karabasil, Mirjana Dimitrijević, Zoran Petrović, Branko Velebit, Vlado Teodorović
"... Fat reduction in meat products is demanded by consumers concerning health issues but represents ..."
 
Vol 1, No 2 (2016) EFFECT OF SUBCRYOSCOPIC STORAGE TEMPERATURE ON THE QUANTITY OF FROZEN-OUT WATER IN NOR AND DFD BEEF Abstract  PDF (Eng)  similar documents
M. A. Dibirasulaev, G. A. Belozerov, D. M. Dibirasulaev, D. E. Orlovsky
"... ,–20, –30 °С for eight types of products (beef, had- dock, cod, redfish, egg protein, yeasts, green ..."
 
Vol 3, No 4 (2018) COMPUTER VISION SYSTEM FOR COLOR MEASUREMENTS OF MEAT AND MEAT PRODUCTS: A REVIEW Abstract  PDF (Eng)  similar documents
Igor B. Tomasevic
"... Meat and meat products color evaluation ability of a computer vision system (CVS) is investigated ..."
 
Vol 2, No 3 (2017) MODELING AS A METHOD FOR SCIENTIFIC COGNITION OF COMPLEX MEAT SYSTEMS Abstract  PDF (Eng)  similar documents
Marina A. Nikitina, Aleksandr N. Zakharov, Victoria V. Nasonova, Andrey B. Lisitsyn
"... The paper examines the issues associated with the integration of knowledge in meat product ..."
 
Vol 2, No 1 (2017) ALTERNATIVE METHODS OF TECHNOLOGICAL PROCESSING TO REDUCE SALT IN MEAT PRODUCTS Abstract  PDF (Eng)  similar documents
E. K. Tunieva, N. A. Gorbunova
"... The world trends in table salt reduction in meat products contemplate the use of different methods ..."
 
Vol 2, No 1 (2017) CRITICAL CONTROL POINT IDENTIFICATION THROUGH TROPHOLOGICAL MEAT PRODUCTION CHAINFROM FIELD TO FORK Abstract  PDF (Eng)  similar documents
A. V. Borodin, I. M. Chernukha, M. A. Nikitina
"... delivery to ready product realization, which is difficult without modern IT-support. The HACCP (Hazard ..."
 
Vol 1, No 2 (2016) THE INFLUENCE OF AUTOLYSIS ON THE PROTEIN-PEPTIDE PROFILE OF Bos taurus AND Sus scrofa HEART AND AORTA TISSUES Abstract  PDF (Eng)  similar documents
I. M. Chernukha, L. V. Fedulova, E. A. Kotenkova, S. S. Shishkin, L. I. Kovalyov
"... of strategies for improvement the functional and technological characteristics of meat and meat products ..."
 
Vol 2, No 1 (2017) BIOINFORMATICS — INSTRUMENT INTERPRETATION PROTEOMIC PROFILES OF MEAT PROTEIN Abstract  PDF (Eng)  similar documents
N. L. Vostrikova, I. M. Chernukha
"... Proteomic technologies have proven very effective for detection in meat products of biochemical ..."
 
Vol 3, No 3 (2018) THE REASONABILITY OF BLUEBERRY CONCENTRATED JUICE APPLICATION IN THE MANUFACTURE OF DRY-CURED PORK Abstract  PDF (Eng)  similar documents
Oksana A. Kovaleva, Katherine M. Zdrabova
"... as an ingredient of the salt mixture were studied. The organoleptic evaluation of the obtained products using ..."
 
Vol 2, No 3 (2017) AN EFFECT OF THE ELECTROMAGNETIC TREATMENT ON OXIDATIVE STABILITY AND MICROBIOLOGICAL SAFETY OF MEAT SEMI-PREPARED PRODUCTS Abstract  PDF (Eng)  similar documents
Marietta A. Aslanova, Andrei S. Dydykin, Lilija V. Fedulova, Olga K. Derevitskaya
"... and pork semi-prepared products in pieces. The semi-prepared products were treated using the experimental ..."
 
Vol 3, No 2 (2018) METHODOLOGICAL ASPECTS OF LIPID EXTRACTION FROM BIOLOGICAL MATRICES Abstract  PDF (Eng)  similar documents
Natal’ya L. Vostrikova, Oksana A. Kuznetsova, Andrey V. Kulikovskii
"... for glycerides, phosphatides, free fatty acids and oxidation products was shown. A number of experiments ..."
 
Vol 1, No 2 (2016) REDOX POTENTIAL AND DYNAMICS OF PROTEIN AND FAT DESTRUCTION DURING STORAGE OF CANNED MEAT IN PIECES Abstract  PDF (Eng)  similar documents
V. B. Krylova
"... fractions in the canned products from beef and pork was different during storage. For example, a decrease ..."
 
Vol 1, No 2 (2016) IDENTIFICATION OF THE MICROBIOLOGICAL RISKS OF CONTAMINATION OF CATTLE AND PIG CARCASSES WITH PATHOGENS AT SLAUGHTER AND PROCESSING Abstract  PDF (Eng)  similar documents
D. S. Bataeva, Yu. K. Yushina, E. V. Zaiko
"... and cuts) and meat semi-prepared products from beef and pork for the presence of the microorganisms ..."
 
Vol 2, No 2 (2017) FREEZING AS A METHOD OF FOOD PRESERVATION Abstract  PDF (Eng)  similar documents
A. L. Ishevskiy, I. A. Davydov
 
Vol 4, No 2 (2019) TECHNOLOGICAL INNOVATIONS FOR TREATMENT OF CASINGS Abstract  PDF (Eng)  similar documents
Vera V. Eveleva, Tatyana M. Cherpalova, Elena A. Shipovskaya
"... for treatment of casings, which provides an increase in microbiological safety of the finished product ..."
 
Vol 1, No 1 (2016) STATISTICAL ANALYSIS OF ENERGY CONSUMPTION DURING THE CUTTING OF FROZEN MEAT BLOCKS USING MULTIPLE EDGE TOOL Abstract  PDF (Eng)  similar documents
A. B. Lisitsyn, V. I. Ivashov, B. R. Kapovsky, O. E. Kozhevnikova
"... of sausages and other meat products. Efficient grinding of frozen raw meat is an urgent task for meat industry ..."
 
Vol 1, No 4 (2016) IDENTIFICATION OF ENTEROTOXIGENIC STAPHYLOCOCCI IN MEAT RAW MATERIALS Abstract  PDF (Eng)  similar documents
D. S. Bataeva, M. Yu. Minaev, A. A. Makhova
"... responsible for production of different types of enterotoxins (A, B, Е, С, D) were found and studied ..."
 
Vol 1, No 1 (2016) PREDICTION OF MEAT PRODUCT QUALITY BY THE MATHEMATICAL PROGRAMMING METHODS Abstract  PDF (Eng)  similar documents
A. B. Lisitsyn, M. A. Nikitina, A. N. Zakharov, E. B. Sus, V. V. Nasonova, L. I. Lebedeva
"... material with animal proteins (beef, pork), and will also allow establishing a relationship of product ..."
 
Vol 2, No 3 (2017) ANTIMICROBIAL SUBSTANCES: AN ALTERNATIVE APPROACH TO THE EXTENSION OF SHELF LIFE Abstract  PDF (Eng)  similar documents
Ekaterina A. Lukinova, Elena A. Kotenkova, Alexander N. Makarenko
"... The problem of high losses of raw materials and products in the food industry is reviewed ..."
 
Vol 1, No 1 (2016) LACTIC ACID BACTERIA AND THEIR ROLE IN THE MEAT PROCESSING Abstract  PDF (Eng)  similar documents
Josef Kameník, Marta Dušková
"... activity against other undesired microorganisms. LAB are important spoilage agents in cooked meat products. ..."
 
Vol 4, No 2 (2019) DEVELOPMENT AND USE OF COMPOSITIONS FROM PRODUCTS OF DEEP PROCESSING OF SECONDARY MEAT RAW MATERIALS Abstract  PDF (Eng)  similar documents
Marianna I. Kremenevskaya, Ruslan V. Dobryagin, Vladimir V. Bogomolov, Sergey I. Snarkiy
"... an increased biological and nutritional value of the developed product. Addition of up to 15 % of the protein ..."
 
Vol 1, No 3 (2016) ASPECTS OF THE DESTRUCTIVE CHANGES IN THE MAIN NUTRIENTS OF CANNED MEAT IN PIECES «STEWED BEEF OF THE TOP GRADE» UNDER THE NON-NORMATIVE TEMPERATURE AND HUMIDITY CONDITIONS OF STORAGE Abstract  PDF (Eng)  similar documents
V. B. Krylova, T. V. Gustova
"... canned foods on the indicators of product safety and quality are topical and important for understanding ..."
 
1 - 50 of 83 Items 1 2 > >> 

Search tips:

  • Search terms are case-insensitive
  • Common words are ignored
  • By default articles containing any term in the query are returned (i.e., OR is implied)
  • Make sure that a word exists in an article by prefixing it with +; e.g., +journal +access scholarly academic
  • Combine multiple words with AND to find articles containing all terms; e.g., education AND research
  • Exclude a word by prefixing it with - or NOT; e.g., online -politics or online NOT politics
  • Search for an exact phrase by putting it in quotes; e.g., "open access publishing". Hint: Quoting Chinese or Japanese words will help you to find exact word matches in mixed-language fields, e.g. "中国".
  • Use parentheses to create more complex queries; e.g., archive ((journal AND conference) NOT theses)