Preview

Theory and practice of meat processing

Advanced search

Search


Order results by:     
 
Issue Title
 
Vol 2, No 3 (2017) INFLUENCE OF ENZYME PREPARATIONS ON MEAT PRODUCTIVITY IN YOUNG PIGS Abstract  PDF (Eng)  similar documents
Nadezhda V. Danilova, Anatoly Yu. Lavrentiev
"... , the average live weight of pigs in experimental groups 1 and 2 increases by 13.1 kg and 5.3 kg, respectively ..."
 
Vol 3, No 4 (2018) THE STUDY OF ORGANOLEPTIC AND FUNCTIONAL-TECHNOLOGICAL PROPERTIES OF PORK MUSCLE TISSUE NOR AND PSE AT THE INDUSTRIAL ENTERPRISES OF THE SOUTHERN FEDERAL DISTRICT Abstract  PDF (Eng)  similar documents
Olga N. Orlova, Vitaliy S. Mkrtichyan, Ludmila V. Skripnik, Ludmila V. Krichun
"... , depending on pre-slaughter preparation. Experimental data of systematization of pork properties ..."
 
Vol 1, No 2 (2016) IDENTIFICATION OF THE MICROBIOLOGICAL RISKS OF CONTAMINATION OF CATTLE AND PIG CARCASSES WITH PATHOGENS AT SLAUGHTER AND PROCESSING Abstract  PDF (Eng)  similar documents
D. S. Bataeva, Yu. K. Yushina, E. V. Zaiko
"... In this work, the risk of contamination of cattle and pig carcasses with pathogens at different ..."
 
Vol 3, No 2 (2018) THE CORRELATION BETWEEN LEAN MEAT PERCENTAGE IN PRIMAL CUTS AND TOTAL LEAN MEAT PERCENTAGE IN CARCASS Abstract  PDF (Eng)  similar documents
Andrey V. Pavlov, Andrey I. Rud, Maxim A. Zankevich
"... With the help of the automated system for the classification of carcasses of pigs, AutoFOM ..."
 
Vol 3, No 4 (2018) THE INFLUENCE OF BIOACTIVE SUBSTANCES ISOLATED FROM PORCINE AORTA ON THE SERUM FATTY ACID COMPOSITION OF HYPERLIPIDEMIC RATS Abstract  PDF (Eng)  similar documents
Irina M. Chernukha, Liliya V. Fedulova, Elena A. Kotenkova
"... kDa) ultrafiltrates of porcine aorta extract. Experimental hyperlipidemia was stimulated in male ..."
 
Vol 1, No 1 (2016) PREDICTION OF MEAT PRODUCT QUALITY BY THE MATHEMATICAL PROGRAMMING METHODS Abstract  PDF (Eng)  similar documents
A. B. Lisitsyn, M. A. Nikitina, A. N. Zakharov, E. B. Sus, V. V. Nasonova, L. I. Lebedeva
"... of the connective and fat tissues. On the basis of the experimental data, the model (stochastic dependence ..."
 
Vol 1, No 4 (2016) INFLUENCE OF THE RADISH HOMOGENATE ON THE FUNCTIONAL AND TECHNOLOGICAL PROPERTIES OF MODEL MINCED MEAT Abstract  PDF (Eng)  similar documents
E. B. Bitueva, T. V. Biltrikova
"... . In the experimental samples, the water binding capacity increased with an increase in the radish homogenate content ..."
 
Vol 2, No 1 (2017) THE STUDY OF THE INFLUENCE OF MODEL MEAT SYSTEMS ON THE ALLERGIC IMMUNE RESPONSE IN VIVO Abstract  similar documents
A. S. Dydykin, M. Yu. Minaev, G. S. Tolmacheva, A. A. Musatova
"... , it is established that experimental products have no negative effect on the clinical parameters of laboratory animals ..."
 
Vol 5, No 2 (2020) An effect of the animal condition after gas stunning on quality of slaughter products from Large White pigs Abstract  PDF (Eng)  similar documents
A. A. Semenova, A. I. Sinichkina, I. V. Kozyrev, T. M. Mittelstein
"... The aim of the research was to establish an effect of gas stunning of pigs at slaughter ..."
 
Vol 2, No 3 (2017) ANTIMICROBIAL SUBSTANCES: AN ALTERNATIVE APPROACH TO THE EXTENSION OF SHELF LIFE Abstract  PDF (Eng)  similar documents
Ekaterina A. Lukinova, Elena A. Kotenkova, Alexander N. Makarenko
"... of pigs and cattle. Such parameters as the molecular weight, isoelectric point, charge, amino acid ..."
 
Vol 3, No 3 (2018) IN VIVO ENRICHMENT OF THE LAMB OF ESSENTIAL TRACE ELEMENTS FOR ITS USE IN THE TECHNOLOGY OF FUNCTIONAL FOODS Abstract  PDF (Eng)  similar documents
Tatiana M. Giro, Ivan F. Gorlov, Marina I. Slozhenkina, Sergey V. Kozlov, Nogman V. Tasmuchanov
"... obtained from the animals of this test group. In processing, the zinc content in the product decreased ..."
 
Vol 2, No 3 (2017) MODELING AS A METHOD FOR SCIENTIFIC COGNITION OF COMPLEX MEAT SYSTEMS Abstract  PDF (Eng)  similar documents
Marina A. Nikitina, Aleksandr N. Zakharov, Victoria V. Nasonova, Andrey B. Lisitsyn
"... and factorial variables, as well as assessing a degree of their correspondence with the experimental data ..."
 
Vol 2, No 1 (2017) STUDY ON THE BIOLOGICAL VALUE OF PROTEINS WITH HYPOTENSIVE PROPERTIES FROM AIR-DRIED BEEF Abstract  PDF (Eng)  similar documents
O. A. Kovaleva, C. M. Zdrabova
"... , in the experimental groups compared to the control groups. ..."
 
Vol 3, No 3 (2018) THE REASONABILITY OF BLUEBERRY CONCENTRATED JUICE APPLICATION IN THE MANUFACTURE OF DRY-CURED PORK Abstract  PDF (Eng)  similar documents
Oksana A. Kovaleva, Katherine M. Zdrabova
"... of the finished experimental products is investigated. The influence of the concentrated juice of blueberries ..."
 
Vol 4, No 1 (2019) STUDY OF GROUND PORK THAWING DYNAMICS USING MAGNETIC RESONANCE IMAGING Abstract  PDF (Eng)  similar documents
Vladimir M. Stefanovskiy, Evgeny V. Morozov, Vyacheslav M. Bоuznik
"... that adequately describes the experimental data obtained in the analysis of tomograms is proposed. Tomograms ..."
 
Vol 2, No 3 (2017) AN EFFECT OF THE ELECTROMAGNETIC TREATMENT ON OXIDATIVE STABILITY AND MICROBIOLOGICAL SAFETY OF MEAT SEMI-PREPARED PRODUCTS Abstract  PDF (Eng)  similar documents
Marietta A. Aslanova, Andrei S. Dydykin, Lilija V. Fedulova, Olga K. Derevitskaya
"... and pork semi-prepared products in pieces. The semi-prepared products were treated using the experimental ..."
 
Vol 1, No 2 (2016) EFFECT OF SUBCRYOSCOPIC STORAGE TEMPERATURE ON THE QUANTITY OF FROZEN-OUT WATER IN NOR AND DFD BEEF Abstract  PDF (Eng)  similar documents
M. A. Dibirasulaev, G. A. Belozerov, D. M. Dibirasulaev, D. E. Orlovsky
"... The comparative assessment of the experimental and computational methods for detecting ..."
 
Vol 4, No 1 (2019) CLIMATE CHANGE: IMPACT ON MYCOTOXINS INCIDENCE AND FOOD SAFETY Abstract  PDF (Eng)  similar documents
Dragan Milicevic, Brankica Lakicevic, Radivoj Petronijevic, Zoran Petrovic, Jelena Jovanovic, Srdjan Stefanovic, Sasa Jankovic
"... are a group of naturally occurring toxic chemical substances, produced mainly by microscopic filamentous ..."
 
Vol 5, No 1 (2020) DEVELOPMENT OF LITHIUM–CONTAINING FEED ADDITIVE AND ITS USE FOR FORTIFICATION OF CHICKEN BROILERS MEAT AND BY-PRODUCTS Abstract  PDF (Eng)  similar documents
Elena A.  Miftahutdinova, Sergey L. Tikhonov, Natal’ya V. Tikhonova
"... meat and by-products in comparison with samples of products taken from the experimental group ..."
 
Vol 4, No 3 (2019) MYOPATHY AS A DESTABILIZING FACTOR OF MEAT QUALITY FORMATION Abstract  PDF (Eng)  similar documents
Anastasiia A. Semenova, Tatiana G. Kuznetsova, Victoria V. Nasonova, Roman V. Nekrasov, Nadezhda V. Bogolyubova
"... a relationship between fast growth of muscle tissue in hybrid pigs, broiler chickens and turkey, and high ..."
 
Vol 1, No 1 (2016) ANTE-MORTEM FORMATION OF THE QUALITATIVE CHARACTERISTICS OF ENVIRONMENTALLY FRIENDLY MEAT RAW MATERIAL BY INTENSIFICATION OF THE MECHANISMS OF THE METABOLIC PROCESSES IN GILTS Abstract  PDF (Eng)  similar documents
T. M. Giro, Zh. G. Egorova, V. S. Avdeenko, A. V. Molchanov
"... . The experiments were carried out in the FGUP “Mummovskoe” – the educational experimental enterprise of the Russian ..."
 
Vol 3, No 1 (2018) THE IMPACT OF THE COOKED SAUSAGE ENRICHED WITH LACTULOSE AND FOOD FIBERS ON THE MORPHOFUNCTIONAL CONDITION OF THE MUCOUS MEMBRANE OF THE LARGE INTESTINE AND MICROBIOTA (MICROBIOCENOSIS) IN RATS Abstract  PDF (Eng)  similar documents
Leonid S. Kudryashov, Vadim A. Kupriyanov, Ivan T. Scherbakov, Valentina B. Krylova, Tatyana V. Gustova
"... of bifido- and lactobacteries in comparison  with the animals control group. Same time, it was found ..."
 
Vol 5, No 3 (2020) Study of the functional product’s protein compounds digestion features Abstract  PDF (Eng)  similar documents
E. R. Vasilevskaya, A. G. Akhremko, E. K. Polishchuk, L. V. Fedulova
"... The aim of the study was to investigate the transformation of meat product’s proteins from pig ..."
 
Vol 2, No 4 (2017) INTESTINAL DYSBIOSIS, HUMAN HEALTH AND FUNCTIONAL NUTRITION Abstract  PDF (Eng)  similar documents
I. Yu. Chicherin, I. P. Pogorelsky, I. A. Lundovskikh, I. V. Darmov, M. R. Shabalina
"... experimental studies on human volunteers, fully confirming previous findings on laboratory animals, according ..."
 
Vol 2, No 2 (2017) QUALITY INDICATORS OF BEEF FROM YOUNG BULLS OF VARIOUS DAIRY AND BEEF BREEDS Abstract  PDF (Eng)  similar documents
S. A. Miroshhikov, A. V. Kharlamov, I. V. Markova
"... It was established that studied meat raw material from young bulls of different breeds (Group I ..."
 
Vol 3, No 2 (2018) METHODOLOGICAL ASPECTS OF LIPID EXTRACTION FROM BIOLOGICAL MATRICES Abstract  PDF (Eng)  similar documents
Natal’ya L. Vostrikova, Oksana A. Kuznetsova, Andrey V. Kulikovskii
"... двухступенчатой экстракции. В качестве опытных образцов использовали специально приготовленные модельные системы ..."
 
Vol 1, No 2 (2016) REDOX POTENTIAL AND DYNAMICS OF PROTEIN AND FAT DESTRUCTION DURING STORAGE OF CANNED MEAT IN PIECES Abstract  PDF (Eng)  similar documents
V. B. Krylova
"... and not systemized, which highlight their topicality. The aim of the research was to obtain the experimental data ..."
 
Vol 1, No 2 (2016) USE OF MEAT-BONE PASTE AS A PROTEIN SOURCE IN MEAT PRODUCT PRODUCTION Abstract  PDF (Eng)  similar documents
A. K. Kakimov, B. B. Kabulov, Zh. S. Yessimbekov, N. A. Kuderinova
"... In this paper, the results of the experimental research on developing the technology of a protein ..."
 
Vol 1, No 3 (2016) RESEARCH AND DEVELOPMENT CONTROL METHOD PATHOGENIC PRION INFECTIONS SECONDARY RAW MEAT INDUSTRY Abstract  PDF (Eng)  similar documents
A. Y. Prosekov, O. V. Kriger
"... DNA-tail. The experimental data indicate that by using AGTCAGTCCTTGGCCTCCTT (left ..."
 
Vol 2, No 3 (2017) RESEARCH METHODOLOGY OF SUS SCROFA TISSUE EXTRACTS PROTEIN-PEPTIDE COMPONENTS Abstract  PDF (Eng)  similar documents
Ekaterina R.. Vasilevskaya, Elena A. Kotenkova, Ekaterina A. Lukinova, Evgenia A. Kalinova
"... ; the method with Bradford reagent and the standard Lowry method. Experimental data analysis demonstrates ..."
 
Vol 5, No 2 (2020) The electrohydraulic method for meat tenderization and curing Abstract  PDF (Eng)  similar documents
N. A. Ermoshin, S. A. Romanchikov, O. I. Nikolyuk
"... expenditure upon heat treatment by 18–20%. As a result of the experimental investigations, it was established ..."
 
Vol 2, No 2 (2017) STUDY STRUCTURE OF THREE-COMPONENT POLYMERIC MATERIAL UNDER INFLUENCE OF γ-IRRADIATION Abstract  PDF (Eng)  similar documents
V. T. Tarasyuk, V. P. Filippovich, A. V. Prokopenko, N. E. Strokova, A. V. Egorkin, A. V. Chasovskikh
"... to 6 kGy. Upon irradiation at doses from 9 kGy and higher, an increase in quantity of ester groups ..."
 
Vol 1, No 3 (2016) ASPECTS OF THE DESTRUCTIVE CHANGES IN THE MAIN NUTRIENTS OF CANNED MEAT IN PIECES «STEWED BEEF OF THE TOP GRADE» UNDER THE NON-NORMATIVE TEMPERATURE AND HUMIDITY CONDITIONS OF STORAGE Abstract  PDF (Eng)  similar documents
V. B. Krylova, T. V. Gustova
"... experimental data on an effect of the non-normative temperature and humidity conditions of the sterilized ..."
 
Vol 1, No 3 (2016) ASSESSMENT OF RADIATION SAFETY OF CHILLED MEAT USING THE METHOD OF ELECTRON PARAMAGNETIC RESONANCE Abstract  PDF (Eng)  similar documents
R. T. Timakova, S. L. Tikhonov, A. N. Tararkov, I. S. Kudryashov
"... products to determine a fact of irradiation and residual effects. The experimental data obtained ..."
 
Vol 1, No 3 (2016) CALCULATION OF PERFORMANCE FOR MECHANICAL DEBONING SCREW PRESSES CONSIDERING COUNTERPRESSURE Abstract  PDF (Eng)  similar documents
A. S. Ostroukh, V. A. Abaldova
"... for a homogeneous medium using Newtonian isothermal models and that their adjustment to experimental data ..."
 
Vol 4, No 4 (2019) Thawing process calculation of egg ingredients particles in minced meat Abstract  PDF (Eng)  similar documents
V. P. Agafonychev, V. N. Makhonina
"... of minced meat. The experimental data of the authors are used as a basis for calculating the process of egg ..."
 
Vol 5, No 1 (2020) RESEARCH OF FUNCTIONAL AND TECHNOLOGICAL PARAMETERS OF HIGH PRESSURE PROCESSED MEAT Abstract  PDF (Eng)  similar documents
Irina A. Prokopenko
"... of a new processing method is being now tested only on experimental installations. For research we selected ..."
 
Vol 3, No 3 (2018) BIOCHEMICAL TRANSFORMATION OF NATURAL LIPIDS: A REVIEW Abstract  PDF (Eng)  similar documents
Marina I. Baburina, Natal’ya L. Vostrikova, Andrew N. Ivankin, Aleksandr N. Zenkin
"... by groups of polyunsaturated, monounsaturated and saturated fatty acids. Some features of simulation ..."
 
Vol 2, No 4 (2017) AN INFLUENCE OF SPONTANEOUS MICROFLORA OF FERMENTED HORSEMEAT PRODUCTS ON THE FORMATION OF BIOLOGICALLY ACTIVE PEPTIDES Abstract  PDF (Eng)  similar documents
I. M. Chernukha, I. N. Nikonov, N. G. Mashentseva, D. L. Klabukova, D. A. Afanasev, L. I. Kovalyov, L. А. Ilina
"... and muscle creatine kinase were found. The obtained materials can be regarded as an experimental basis ..."
 
Vol 2, No 2 (2017) MEAT PRODUCTIVITY THE QUALITY OF RAW MEAT OF ANIMALS OF KALMYK BREED NEW FACTORY LINES Abstract  PDF (Eng)  similar documents
V. N. Pristupa, A. Y. Kolosov, Y. A. Kolosov, O. N. Orlova, L. S. Dmitrieva, V. I. Eroshenko, L. V. Skripnik, D. V. Torosyan
"... experimental animals were characterized by a good yield of deboned meat (82.3 to 82.6%) with a relatively small ..."
 
Vol 1, No 3 (2016) PRINCIPLES OF DETERMINATION OF VALUE IN USE FOR MEAT AND MEAT PRODUCTS BASED ON QUALITY INDICATORS — THE COEFFICIENTS OF CONSUMER PROPERTIES Abstract  PDF (Eng)  similar documents
N. F. Neburchilova, I. V. Petrunina
"... setting for different groups of products, the unified method of price equivalence with regard ..."
 
Vol 1, No 4 (2016) RESEARCHING OF MEAT AND FAT COLOUR AND MARBLING IN BEEF Abstract  PDF (Eng)  similar documents
A. B. Lisitsyn, I. V. Kozyrev
"... to define groups by the colour values according to Lab international colour model. Measurements were ..."
 
Vol 2, No 2 (2017) TECHNOLOGICAL PROPERTIES OF CHILLED BEEF OF VARIOUS COLOR CLASSES Abstract  PDF (Eng)  similar documents
I, V. Kozyrev, T. M. Mittelstein, V. A. Pchelkina, A. B. Lisitsyn
"... to color standards. According to differences in color, beef was sorted into three groups using color ..."
 
Vol 2, No 4 (2017) CONCEPTUAL APPROACHES TO THE RAPID DETECTION OF CAMPYLOBACTER SPP. IN MEAT OF SLAUGHTER ANIMALS Abstract  PDF (Eng)  similar documents
D. S. Bataeva, M. Yu. Minaev, Yu. K. Yushina, O. V. Sokolova, E. V. Zajko
"... that the selected primers were 100% specific and did not give false positive reactions with this group ..."
 
Vol 5, No 3 (2020) A system approach to simulation of individual food products Abstract  PDF (Eng)  similar documents
A. B. Lisitsyn, I. M. Chernukha, M. A. Nikitina
"... production of personalized food products for individuals or small groups of people is unfeasible. The devel ..."
 
1 - 45 of 45 Items

Search tips:

  • Search terms are case-insensitive
  • Common words are ignored
  • By default articles containing any term in the query are returned (i.e., OR is implied)
  • Make sure that a word exists in an article by prefixing it with +; e.g., +journal +access scholarly academic
  • Combine multiple words with AND to find articles containing all terms; e.g., education AND research
  • Exclude a word by prefixing it with - or NOT; e.g., online -politics or online NOT politics
  • Search for an exact phrase by putting it in quotes; e.g., "open access publishing". Hint: Quoting Chinese or Japanese words will help you to find exact word matches in mixed-language fields, e.g. "中国".
  • Use parentheses to create more complex queries; e.g., archive ((journal AND conference) NOT theses)